Risk stratification in acute myeloid leukemia (AML) is currently based on pretreatment characteristics. It remains to be established whether relapse risk can be better predicted through assessment of minimal residual disease (MRD). One proposed marker is the Wilms tumor gene WT1, which is overexpressed in most patients with AML, thus providing a putative target for immunotherapy, although in the absence of a standardized assay, its utility for MRD monitoring remains controversial.

Nine published and in-house real-time quantitative polymerase chain reaction WT1 assays were systematically evaluated within the European LeukemiaNet; the best-performing assay was applied to diagnostic AML samples (n = 620), follow-up samples from 129 patients treated with intensive combination chemotherapy, and 204 normal peripheral blood (PB) and bone marrow (BM) controls.

Considering relative levels of expression detected in normal PB and BM, WT1 was sufficiently overexpressed to discriminate ≥ 2-log reduction in transcripts in 46% and 13% of AML patients, according to the respective follow-up sample source. In this informative group, greater WT1 transcript reduction after induction predicted reduced relapse risk (hazard ratio, 0.54 per log reduction; 95% CI, 0.36 to 0.83; P = .004) that remained significant when adjusted for age, WBC count, and cytogenetics. Failure to reduce WT1 transcripts below the threshold limits defined in normal controls by the end of consolidation also predicted increased relapse risk (P = .004).

Application of a standardized WT1 assay provides independent prognostic information in AML, lending support to incorporation of early assessment of MRD to develop more robust risk scores, to enhance risk stratification, and to identify patients who may benefit from allogeneic transplantation.

Current treatment protocols for acute myeloid leukemia (AML) are based on prognostic factors that contribute to therapy stratification.1,2 Key prognostic factors so far identified include pretreatment characteristics such as age, WBC count, karyotype, mutation status of the FLT3, NPM1, and CEBPA genes and relative levels of expression of BAALC, EVI1, and ERG.38 Morphologic response to induction chemotherapy provides an additional predictive factor, which has been incorporated into current risk stratification schemes used to inform decisions regarding consolidation therapy, particularly allogeneic transplantation.9 Although such parameters distinguish groups of patients at broadly differing risk of relapse, there is a pressing need to refine risk stratification to more reliably identify those patients most (and least) likely to benefit from transplantation. A number of studies have highlighted the potential of minimal residual disease (MRD) monitoring by real-time quantitative polymerase chain reaction (RQ-PCR) to detect leukemia-specific targets (ie, fusion gene transcripts such as PML-RARA or mutations such as that in NPM1) that would reveal those patients at highest risk of relapse and provide an opportunity for early treatment intervention (10). However, approximately half of AML patients lack a suitable leukemia-specific target; thus there has been considerable interest in developing alternative approaches to allow MRD detection to be extended to a much greater proportion of patients. One strategy involves use of flow cytometry to identify and monitor leukemia-associated aberrant phenotypes; it has the advantage of wide applicability, but it is technically demanding.10 Another approach involves using RQ-PCR assays to detect transcripts that are highly overexpressed in AML blasts relative to normal PB and BM, with most of the attention being focused on the Wilms tumor (WT1) gene.10

WT1 was originally identified for its involvement in the pathogenesis of Wilms tumor (reviewed11) and has been shown to be highly expressed in several hematopoietic tumors, including AML.1125 Although the mechanisms leading to WT1 overexpression remain poorly understood, this phenomenon can be exploited as a marker to establish the presence, persistence, or reappearance of leukemic hematopoiesis. However, the clinical utility of WT1 monitoring has been somewhat controversial, which may in part reflect differences in performance of the assays evaluated to date. It has become apparent that a number of RQ-PCR assays are designed to amplify 3′ regions of the gene, where mutations that occur in approximately 10% of AML patients tend to cluster,2630 potentially giving rise to false-negative results.31 Therefore, we established a network of 11 laboratories within the MRD Workpackage of the European LeukemiaNet (ELN) to systematically evaluate nine published and in-house WT1 RQ-PCR assays, leading to the selection of a standardized assay with optimal performance that was shown to provide an independent prognostic factor in AML.

RNA Extraction, cDNA Synthesis, and RQ-PCR

Total RNA was extracted and reverse transcribed using the standardized protocol developed within the Europe Against Cancer (EAC) program.32 RQ-PCR assays were performed using EAC conditions, with primers and probes at final concentrations of 300 nmol/L and 200 nmol/L, respectively.32 Primers and probes for WT1 assays and the published EAC ABL control gene assay33 were centrally distributed along with respective plasmid standards (a kind gift from Ipsogen, Marseille, France). RQ-PCR assays were predominantly performed on Applied Biosystems platforms (ABI7000/7700/7900; Applied Biosystems, Foster City, CA); one laboratory used the Lightcycler 1.5 (Roche Applied Science, Penzberg, Germany), one used a Rotor-Gene instrument (3000/3000A; Corbett Life Science, Sydney, Australia), and one used the Mx3000P (Stratagene, La Jolla, CA). Data were reported using a common threshold of 0.1, where the Ct (cycle threshold) value denotes the PCR cycle at which fluorescence is detected above the background level (reviewed34). WT1 transcripts were normalized to ABL by using the respective plasmid standards to generate normalized copy numbers in addition to using the ΔCt method.35 All assays were run in triplicate wells with appropriate water controls. To define sensitivities for the WT1 assays under evaluation, the detection limit was designated as the lowest dilution of a WT1-positive cell line (HL60) giving rise to amplification above the background level (ie, normalized WT1 ΔCt ≥ 1) detected in peripheral blood lymphocytes (PBLs) in at least two of three replicates with Ct ≤ 40. For analysis of AML samples and normal controls, those with detectable WT1 copy numbers (ie, with specific amplification in at least two of three replicates with Ct ≤ 40) were expressed per 104 ABL copies. Follow-up samples with ABL Ct more than 29 were excluded from analysis, according to EAC criteria.32 Samples were studied after institutional review board approval, and informed patient consent was provided in accordance with the Declaration of Helsinki.

Selection of the Best-Performing WT1 RQ-PCR Assay

The selection and evaluation process involved analyses conducted in 11 leukemia diagnostic laboratories spread across eight countries within the MRD Workpackage (WP12) of the European LeukemiaNet (www.leukemia-net.org). In phase I, nine published and in-house WT1 RQ-PCR assays (designated assays 1 to 9) were systematically evaluated (Fig 1, Table 1; Appendix Table A1, online only, for primer and probe sequences). These were tested on cDNA obtained from serial dilutions of HL60 AML cells (in which WT1 is highly expressed) into normal PBLs. All assays were also tested on cDNAs derived from undiluted HL60 cells and PBLs. RNA specificity of each assay was evaluated by including analysis of “no reverse transcriptase” controls and genomic DNA as described.34 On the basis of the performance profile, particularly in terms of sensitivity and RNA specificity, three assays were excluded at this stage (Fig 1; Table 1). In phase II, the remaining six assays were tested in parallel in the reference laboratory in Turin on a full-length WT1 plasmid standard (Ipsogen). Primary data were reviewed by members of all 11 participating laboratories; the three assays with the best performance (ie, efficiency and sensitivity) were taken forward to phase III, which involved parallel analysis by the network of laboratories on centrally distributed plasmid standards and cDNAs derived from serial dilutions of HL60 cells in PBLs. Assay 9, published previously by Van Dijk et al,37 (forward primer, 5′-CGCTATTCGCAATCAGGGTTA-3′; reverse primer, 5′-GGGCGTGTGACCGTAGCT-3′; probe, 5′-FAM-AGCACGGTCACCTTCGACGGGA-TAMRA-3′) was selected as the ELN WT1 assay and evaluated in normal control and AML patient samples (phase IV).

Table

Table 1. Details and Relative Performance of Nine WT1 Assays Evaluated Within the European LeukemiaNet

Table 1. Details and Relative Performance of Nine WT1 Assays Evaluated Within the European LeukemiaNet

WT1 Assay Assay Location Assay Reference Sensitivity to Detect WT1 in HL60 Cell Line Dilutions Phase of Exclusion Reason for Exclusion
1 Exons 6-7 Ogawa et al22 10−3 I Lack of RNA specificity*
2 Exons 7-8 Osborne et al36 10−2 II Reduced efficiency and sensitivity
3 Exons 6-7 Østergaard et al23 10−4 III Location of primers and probe
4 Exons 7-8 Unpublished 10−3 I Reduced efficiency and sensitivity
5 Exons 7-8 Unpublished 10−3 II Reduced efficiency and sensitivity
6 Exons 7-8 Unpublished 10−2 I Low sensitivity
7 Exons 7-8 Unpublished 10−4 II Lower level of efficiency
8 Exons 7-8 Cilloni et al15 10−3-10−4 III Inferior level of efficiency
9 Exons 1-2 Van Dijk et al37 10−4 Not excluded Not applicable

*All other assays were confirmed to be RNA-specific.

Patient and Normal Control Samples

Reference values of normalized WT1 transcript levels in normal peripheral blood (PB), bone marrow (BM), and PB stem cells (PBSCs) were established using the selected ELN WT1 assay by analyzing a total of 118 PB, 61 BM, and 25 granulocyte colony-stimulating factor mobilized PBSC samples collected from healthy volunteers. To investigate the range of WT1 expression observed in AML, 620 pretreatment samples (238 PB, 382 BM) derived from 504 patients (median age, 45 years; range, 0 to 85 years) were studied. The predictive value of MRD assessment using the ELN WT1 assay was determined in a cohort of 129 patients (median age, 45 years; range, 2 to 76 years) treated with intensive anthracycline and cytarabine–based combination chemotherapy.3842 To establish whether hematopoietic regeneration following chemotherapy modulates WT1 expression, follow-up samples were analyzed from a cohort of 16 patients with AML in which pretreatment WT1 transcript levels were shown to be low, comparable to those observed in normal BM (< 250 copies/104 ABL copies).

Detection of Mutations in the WT1 Gene

Given that the ELN assay spans exons 1 and 2 of the WT1 gene, in 32 patients with AML found to have low WT1 expression at diagnosis (drawn from the cohort of 504 patients), the 5′ region of the gene was PCR-amplified using primers ATGGGCTCCGACGTGCGGGAC and TCAAAGCGCCAGCTGGAGTTTGG. The 5′ region was then sequenced to investigate for possible mutations disrupting the primer or probe binding sites by using standard methods and the ABI PRISM 3100 genetic analyzer (Applied Biosystems).35 To determine whether the presence of mutations in the 3′ region (exons 7 and 9) of WT1 was correlated with differences in WT1 expression level (as determined by the ELN assay with respect to patients with wild-type WT1), cDNAs from AML patients of known mutation status28 (gift from Jude Fitzgibbon, St Bartholemew's Hospital, London, United Kingdom) were received for analysis.

Statistical Analyses

Correlations between continuous variables were calculated using Spearman's correlation coefficient. Comparison between two groups of continuous variables was performed using the nonparametric Mann-Whitney U test; 2 × 2 contingency tables were analyzed using the Mantel-Haenszel test. Survival analyses were performed using either the log-rank test for comparison of two groups or Cox regression for continuous covariate or multivariable analysis. Cytogenetic risk groups were defined according to the original Medical Research Council classification.43 Significance was set at P < .05.

Definition of the Best-Performing WT1 RQ-PCR Assay

As a first step to selecting the optimal assay for MRD assessment in AML, nine published and in-house WT1 RQ-PCR assays were evaluated in parallel on serial dilutions of HL60 cells in normal PBLs that exhibit high and low levels of WT1 expression, respectively (phase I, Fig 1). Comparison of WT1 expression in HL60 cells relative to ABL expression using the ΔCt method suggested significant differences in efficiency between the assays, which had an impact on the maximal achievable sensitivities to detect WT1 transcripts (Appendix Table A2, online only). In phase II, six assays with better performance profiles were taken forward for parallel evaluation on WT1 plasmid standards, which revealed variation in assay efficiency and sensitivity (Appendix Table A3, online only). The three best-performing assays (assays 3, 8, and 9) were analyzed in parallel on centrally distributed plasmid standards and cDNA dilution series of HL60 in PBLs in phase III (Fig 1). Assay 8 was found to be less efficient on standard curve analysis (Appendix Fig A1, online only). Assays 3 and 9 were comparable in their performance profile (Appendix Figs A1 and A2, online only) and given that the region amplified by the former is more prone to mutation in AML,2630 assay 9 (hereinafter ELN WT1 assay) published previously by Van Dijk et al37 was selected for validation.

WT1 Expression in Samples Collected From Healthy Participants

Given that WT1 is expressed in normal hematopoietic cells, it is critical to establish levels of expression observed in normal control samples so that thresholds can be defined that distinguish residual leukemia from background amplification. Analysis of 204 control samples derived from healthy volunteers using the ELN WT1 assay confirmed that WT1 expression in PB, BM, and PBSC samples is low, with a median value of 19.8 WT1 copies/104 ABL copies (range, 0 to 213) in BM, 0.01 (range, 0.01 to 47.6) in PB, and 6.1 (range, 0 to 39) in PBSC (Fig 2). WT1 expression in PB was significantly lower than in BM (P < .0001). Based on these results, the upper limit of normal was defined as 250 copies for BM and 50 copies for PB.

Defining WT1 Expression by Standardized ELN RQ-PCR Assay in Pretreatment AML Samples

To evaluate the applicability of the ELN WT1 RQ-PCR assay to detect MRD, 620 pretreatment samples (238 PB and 382 BM) from 504 patients were analyzed. WT1 was overexpressed above background (defined as > 250 and > 50 WT1 copies/104 ABL copies in BM and PB, respectively) in 86% and 91% of BM and PB diagnostic AML samples, respectively (Fig 2). The median value of WT1 copies/104 ABL copies was 2,505 (range, 0 to 7.5 × 105) in BM (P < .0001 v normal BM) and 3,107 (range, 0 to 1.13 × 106) in PB (P < .0001 v normal PB). There was no significant difference in expression between PB and BM across the whole cohort, as confirmed by results obtained in patients with paired diagnostic PB and BM samples (Appendix Fig A3, online only). Considering the upper threshold limits defined in normal control samples, WT1 expression was sufficiently high at diagnosis to allow detection of at least a 2-log reduction in transcripts in 46% and 13% of AML patients according to whether PB or BM samples are used to assess MRD status. Variation in normalized WT1 expression level was observed according to cytogenetics (Fig 3; P < .001), with particularly high levels in patients with inv16 (median, 2.31 × 104; range, 12 to 3.14 × 105). Significantly higher WT1 levels were also detected in AML with NPM1 mutations (NPM1 mutant: median, 1.44 × 104; range, 0 to 1.13 × 106; NPM1 wild type: median, 6,566; range, 0 to 7.5 × 105; P = .005).

The levels of WT1 expression (as defined by ELN WT1 assay) in 15 patients harboring mutations in exons 7 and 9 of the WT1 gene were comparable to patients with wild type WT1 (P = .2). However, sequence analysis of a series of 32 patients in which the ELN WT1 assay suggested a low level of WT1 transcript expression (< 250 copies/104 ABL copies), showed that in three patients (9.4%), this was associated with mutations that disrupted the forward primer binding site (Appendix Fig A4, online only).

Prognostic Significance of MRD Detection by ELN WT1 Assay in AML

To establish the potential utility of any overexpressed gene as a putative MRD target, it is critical to exclude the possibility that the transcript in question is significantly modulated on regeneration after chemotherapy. Therefore, serial follow-up PB and BM samples taken from 16 patients in whom diagnostic samples revealed low levels of WT1 transcripts (< 250 copies/104 ABL copies) were analyzed. No significant impact of hematopoietic recovery on normalized WT1 levels was observed (P = .1); these levels remained below the upper limits defined in normal PB and BM samples (Appendix Fig A5, online only).

To investigate the predictive value of MRD assessment using the ELN WT1 assay, follow-up samples were analyzed from a cohort of 129 adults treated with conventional anthracycline and cytarabine-based chemotherapy in which diagnostic WT1 levels exceeded 2 × 104 copies/104 ABL copies, allowing discrimination of at least a 2-log reduction compared with the pretreatment level. Greater reduction in WT1 after the first cycle of chemotherapy predicted a decreased risk of subsequent relapse (hazard ratio [HR] 0.54; range, 0.36 to 0.83 per log reduction; P = .004; Fig 4), with no evidence of heterogeneity according to treatment protocol (P = .4). Regression analysis demonstrated that the magnitude of WT1 log reduction after induction chemotherapy provided an independent predictor of relapse, remaining significant when adjusting either for age (HR, 0.54; range, 0.35 to 0.83; P = .005), WBCs (HR, 0.54; range, 0.35 to 0.81; P = .003), or cytogenetic risk group (HR, 0.63; range, 0.41 to 0.98; P = .04). Magnitude of log reduction in WT1 transcripts after induction remained highly significant when censoring at time of transplantation undertaken in first remission (HR, 0.42; range, 0.25 to 0.69; P = .0007). The prognostic impact of normalized WT1 transcript level was also determined immediately after completion of consolidation; at this time point, detection of WT1 transcripts at a level exceeding the upper normal values predicted a significantly increased risk of relapse (67% v 42% at 5 years; HR, 0.23; range, 0.09 to 0.63; P = .004).

A number of studies have highlighted the opportunity afforded by the overexpression of the WT1 gene in the majority of AML patients to provide a target for novel immunotherapeutic approaches and to advocate it as a universal marker for MRD assessment.10,44,45 The value of WT1 monitoring in AML has been a matter of some debate; however, optimized assays are becoming increasingly important as tools for enhancing risk stratification in AML and assessing response to WT1-targeted therapies. To address this issue we undertook a systematic evaluation of a range of published WT1 assays; this evaluation revealed marked variation in performance that is likely to have an impact on their clinical utility. Our assessment led to the selection of an assay with superior performance that afforded a sensitivity of 1 in 104 in cell-line dilutions. Moreover, analysis of a large number of control samples has allowed us to establish reference ranges for WT1 expression in normal PB, BM, and PBSCs, which enables transcript levels indicative of residual leukemia to be distinguished from background levels. The location of the selected ELN WT1 assay spanning exons 1 and 2 is also advantageous, since this region is less prone to mutations than exons 7 and 9, where the majority of WT1 assays are situated and thus could give rise to false-negative results.2631 Indeed, in a focused analysis of AML patients in whom WT1 expression fell within the normal range, as determined by the ELN WT1 assay, 9.4% were found to harbor mutations in the amplified region.

While some studies have reported that pretreatment WT1 expression level is predictive of outcome,12,16,46 it was not confirmed in this study (P = .8). However, in accordance with previous studies,16,19,21,23 we found that determining the kinetics of WT1 transcript reduction following induction chemotherapy provides a key prognostic factor, distinguishing patients at differing risk of relapse within cytogenetically defined risk groups. We also found that failure to normalize WT1 transcript level by the postconsolidation time point distinguishes a group of patients at significantly increased risk of relapse. Together, these results highlight the potential of early assessment of WT1 transcript reduction to identify residual leukemic cells and enhance risk stratification schemes in AML.

There has also been interest in the potential for WT1 to provide a target for sequential MRD monitoring, particularly as a tool to direct the need for treatment modification following allogeneic transplantation, including donor leukocyte infusion.22 WT1 appears not to be modulated on engraftment following transplantation22; through the analysis of sequential follow-up samples taken from patients with AML in which WT1 was not overexpressed, we have been able to show that WT1 expression is not significantly modulated during hematopoietic recovery following intensive chemotherapy. In addition, when background levels of expression observed in normal PB and BM are taken into account, our data show that the degree of WT1 overexpression in most patients with AML is too modest to afford a highly sensitive universal marker for sequential MRD monitoring but nevertheless show that early assessment of decline in WT1 transcripts following therapy in informative patients is highly predictive of risk of subsequent relapse.

Importantly, the establishment of a standardized WT1 assay with independent prognostic value in AML provides a firm basis for determining prospectively in large-scale multicenter clinical trials whether early MRD assessment using this target to define kinetics of disease response can serve to further refine risk stratification to dictate consolidation therapy including transplantation and whether this approach will lead to meaningful improvements in survival. Such studies should evaluate paired PB and BM samples to establish which is most informative, considering background levels of WT1 expression in the respective normal tissues. While the majority of follow-up samples analyzed were BM aspirates, our study suggests that use of PB may increase the proportion of patients in whom WT1 can be used to assess treatment response. Finally, this study has established a standardized assay to assess patients who are potential candidates for WT1-directed therapies and to monitor response to such treatment approaches at the molecular level.

© 2009 by American Society of Clinical Oncology

Supported by Leukaemia Research of Great Britain and the European LeukemiaNet (J.V.J. and D.G.).

Authors' disclosures of potential conflicts of interest and author contributions are found at the end of this article.

Although all authors completed the disclosure declaration, the following author(s) indicated a financial or other interest that is relevant to the subject matter under consideration in this article. Certain relationships marked with a “U” are those for which no compensation was received; those relationships marked with a “C” were compensated. For a detailed description of the disclosure categories, or for more information about ASCO's conflict of interest policy, please refer to the Author Disclosure Declaration and the Disclosures of Potential Conflicts of Interest section in Information for Contributors.

Employment or Leadership Position: Fabienne Hermitte, Ipsogen (C); Susanne Schnittger, MLL Munich Leukemia Laboratory (C); Tamara Weiss, MLL Munich Leukemia Laboratory (C) Consultant or Advisory Role: David Grimwade, Ipsogen (U) Stock Ownership: Fabienne Hermitte, Ipsogen; Susanne Schnittger, MLL Munich Leukemia Laboratory Honoraria: None Research Funding: None Expert Testimony: None Other Remuneration: None

Conception and design: Daniela Cilloni, Giuseppe Saglio, David Grimwade

Financial support: Giuseppe Saglio, David Grimwade

Administrative support: Giuseppe Saglio, David Grimwade

Provision of study materials or patients: Daniela Cilloni, Aline Renneville, Fabienne Hermitte, Sarah Daly, Enrico Gottardi, Milena Fava, Susanne Schnittger, Tamara Weiss, Barbara Izzo, Josep Nomdedeu, Adrian van der Heijden, Bert A. van der Reijden, Joop H. Jansen, Vincent H.J. van der Velden, Hans Ommen, Claude Preudhomme, Giuseppe Saglio

Collection and assembly of data: Daniela Cilloni, Aline Renneville, Sarah Daly, Jelena V. Jovanovic, Enrico Gottardi, Milena Fava, Susanne Schnittger, Tamara Weiss, Barbara Izzo, Josep Nomdedeu, Adrian van der Heijden, Bert A. van der Reijden, Joop H. Jansen, Vincent H.J. van der Velden, Hans Ommen, Claude Preudhomme, David Grimwade

Data analysis and interpretation: Daniela Cilloni, Aline Renneville, Robert K. Hills, Sarah Daly, Jelena V. Jovanovic, Enrico Gottardi, Milena Fava, Tamara Weiss, Barbara Izzo, Josep Nomdedeu, Adrian van der Heijden, Joop H. Jansen, Vincent H.J. van der Velden, Hans Ommen, David Grimwade

Manuscript writing: Daniela Cilloni, Robert K. Hills, David Grimwade

Final approval of manuscript: Daniela Cilloni, Aline Renneville, Fabienne Hermitte, Robert K. Hills, Sarah Daly, Jelena V. Jovanovic, Enrico Gottardi, Milena Fava, Susanne Schnittger, Tamara Weiss, Barbara Izzo, Josep Nomdedeu, Adrian van der Heijden, Bert A. van der Reijden, Joop H. Jansen, Vincent H.J. van der Velden, Hans Ommen, Claude Preudhomme, Giuseppe Saglio, David Grimwade

1. BD Cheson, JM Bennett, KJ Kopecky , etal: Revised recommendations of the International Working Group for Diagnosis, Standardization of Response Criteria, Treatment Outcomes, and Reporting Standards for Therapeutic Trials in Acute Myeloid Leukemia J Clin Oncol 21: 46424649,2003 LinkGoogle Scholar
2. E Estey, H Döhner: Acute myeloid leukemia Lancet 368: 18941907,2006 Crossref, MedlineGoogle Scholar
3. K Mrózek, NA Heerema, CD Bloomfield: Cytogenetics in acute leukemia Blood Rev 18: 115136,2004 Crossref, MedlineGoogle Scholar
4. PD Kottaridis, RE Gale, DC Linch: Flt3 mutations and leukaemia Br J Haematol 122: 523538,2003 Crossref, MedlineGoogle Scholar
5. B Falini, C Mecucci, E Tiacci , etal: Cytoplasmic nucleophosmin in acute myelogenous leukemia with a normal karyotype N Engl J Med 352: 254266,2005 Crossref, MedlineGoogle Scholar
6. K Mrózek, CD Bloomfield: Chromosome aberrations, gene mutations and expression changes, and prognosis in adult acute myeloid leukemia Hematology Am Soc Hematol Educ Program 169177,2006 Crossref, MedlineGoogle Scholar
7. RF Schlenk, K Döhner, J Krauter , etal: Mutations and treatment outcome in cytogenetically normal acute myeloid leukemia N Engl J Med 358: 19091918,2008 Crossref, MedlineGoogle Scholar
8. S Lugthart, E van Drunen, Y van Norden , etal: High EVI1 levels predict adverse outcome in acute myeloid leukemia: Prevalence of EVI1 overexpression and chromosome 3q26 abnormalities underestimated Blood 111: 43294337,2008 Crossref, MedlineGoogle Scholar
9. K Wheatley, AK Burnett, AH Goldstone , etal: A simple, robust, validated and highly predictive index for the determination of risk-directed therapy in acute myeloid leukaemia derived from the MRC AML 10 trial: United Kingdom Medical Research Council's Adult and Childhood Leukaemia Working Parties Br J Haematol 107: 6979,1999 Crossref, MedlineGoogle Scholar
10. SD Freeman, JV Jovanovic, D Grimwade: Development of minimal residual disease-directed therapy in acute myeloid leukemia Semin Oncol 4: 388400,2008 CrossrefGoogle Scholar
11. H Sugiyama: Wilms' tumor gene WT1: its oncogenic function and clinical application Int J Hematol 73: 177187,2001 Crossref, MedlineGoogle Scholar
12. K Inoue, H Sugiyama, H Ogawa , etal: WT1 as a new prognostic factor and a new marker for the detection of minimal residual disease in acute leukemia Blood 84: 30713079,1994 Crossref, MedlineGoogle Scholar
13. K Inoue, H Ogawa, T Yamagami , etal: Long-term follow-up of minimal residual disease in leukemia patients by monitoring WT1 (Wilms tumor gene) expression levels Blood 88: 22672278,1996 Crossref, MedlineGoogle Scholar
14. K Inoue, H Ogawa, Y Sonoda , etal: Aberrant overexpression of the Wilms tumor gene (WT1) in human leukemia Blood 89: 14051412,1997 Crossref, MedlineGoogle Scholar
15. D Cilloni, E Gottardi, D De Micheli , etal: Quantitative assessment of WT1 expression by real time quantitative PCR may be a useful tool for monitoring minimal residual disease in acute leukemia patients Leukemia 16: 21152121,2002 Crossref, MedlineGoogle Scholar
16. J Trka, M Kalinova, O Hrusak , etal: Real-time quantitative PCR detection of WT1 gene expression in children with AML: Prognostic significance, correlation with disease status and residual disease detection by flow cytometry Leukemia 16: 13811389,2002 Crossref, MedlineGoogle Scholar
17. D Cilloni, E Gottardi, M Fava , etal: Usefulness of quantitative assessment of the WT1 gene transcript as a marker for minimal residual disease detection Blood 102: 773774,2003 Crossref, MedlineGoogle Scholar
18. M Weisser, W Kern, S Rauhut , etal: Prognostic impact of RT-PCR based quantification of WT1 gene expression during MRD monitoring of acute myeloid leukemia Leukemia 19: 14161423,2005 Crossref, MedlineGoogle Scholar
19. H Lapillonne, A Renneville, A Auvrignon , etal: High WT1 expression after induction therapy predicts high risk of relapse and death in pediatric acute myeloid leukemia J Clin Oncol 24: 15071515,2006 LinkGoogle Scholar
20. D Cilloni, F Messa, F Arruga , etal: Early prediction of treatment outcome in acute myeloid leukemia by measurement of WT1 transcript levels in peripheral blood samples collected after chemotherapy Haematologica 93: 921924,2008 Crossref, MedlineGoogle Scholar
21. M Garg, H Moore, K Tobal , etal: Prognostic significance of quantitative analysis of WT1 gene transcripts by competitive reverse transcription polymerase chain reaction in acute leukaemia Br J Haematol 123: 4959,2003 Crossref, MedlineGoogle Scholar
22. H Ogawa, H Tamaki, K Ikegame , etal: The usefulness of monitoring WT1 gene transcripts for the prediction and management of relapse following allogeneic stem cell transplantation in acute type leukemia Blood 101: 16981704,2003 Crossref, MedlineGoogle Scholar
23. M Østergaard, LH Olesen, H Hasle , etal: WT1 gene expression: An excellent tool for monitoring minimal residual disease in 70% of acute myeloid leukaemia patients—Results from a single-centre study Br J Haematol 125: 590600,2004 Crossref, MedlineGoogle Scholar
24. HB Ommen, CG Nyvold, K Braendstrup , etal: Relapse prediction in acute myeloid leukaemia patients in complete remission using WT1 as a molecular marker: Development of a mathematical model to predict time from molecular to clinical relapse and define optimal sampling intervals Br J Haematol 141: 782791,2008 Crossref, MedlineGoogle Scholar
25. J Liu-Yin, M Sale, S Daly , etal: Predictive value of minimal residual disease (MRD) monitoring by RQ-PCR in WT1 positive patients entered in the UK MRC AML-15 Trial Blood 112: 259,2008 abstr 697 CrossrefGoogle Scholar
26. L King-Underwood, K Pritchard-Jones: Wilms' tumor (WT1) gene mutations occur mainly in acute myeloid leukemia and may confer drug resistance Blood 91: 29612968,1998 Crossref, MedlineGoogle Scholar
27. K Summers, J Stevens, I Kakkas , etal: Wilms' tumour 1 mutations are associated with FLT3-ITD and failure of standard induction chemotherapy in patients with normal karyotype AML Leukemia 21: 550551,2007 Crossref, MedlineGoogle Scholar
28. P Virappane, R Gale, R Hills , etal: Mutation of the Wilms' tumor 1 gene is a poor prognostic factor associated with chemotherapy resistance in normal karyotype acute myeloid leukemia: The United Kingdom Medical Research Council Adult Leukaemia Working Party J Clin Oncol 26: 54295435,2008 LinkGoogle Scholar
29. P Paschka, G Marcucci, AS Ruppert , etal: Wilms' tumor 1 gene mutations independently predict poor outcome in adults with cytogenetically normal acute myeloid leukemia: A Cancer and Leukemia Group B study J Clin Oncol 26: 45954602,2008 LinkGoogle Scholar
30. VI Gaidzik, RF Schlenk, S Moschny , etal: Prognostic impact of WT1 mutations in cytogenetically normal acute myeloid leukemia (AML): A study of the German-Austrian AML Study Group (AMLSG) Blood 113: 45054511,2009 Crossref, MedlineGoogle Scholar
31. CG Nyvold, J Stentoft, K Braendstrup , etal: Wilms' tumor 1 mutation accumulated during therapy in acute myeloid leukemia: Biological and clinical implications Leukemia 20: 20512054,2006 Crossref, MedlineGoogle Scholar
32. J Gabert, E Beillard, VHJ van der Velden , etal: Standardization and quality control studies of ‘real-time’ quantitative reverse transcriptase polymerase chain reaction of fusion gene transcripts for residual disease detection in leukemia - a Europe Against Cancer program Leukemia 17: 23182357,2003 Crossref, MedlineGoogle Scholar
33. E Beillard, N Pallisgaard, VHJ van der Velden , etal: Evaluation of candidate control genes for diagnosis and residual disease detection in leukemic patients using ‘real-time’ quantitative reverse-transcriptase polymerase chain reaction (RQ-PCR): A Europe Against Cancer program Leukemia 17: 24742486,2003 Crossref, MedlineGoogle Scholar
34. R Flora, D Grimwade: Real-time quantitative RT-PCR to detect fusion gene transcripts associated with AML Methods Mol Med 91: 151173,2004 MedlineGoogle Scholar
35. D Grimwade, JV Jovanovic, RK Hills , etal: Prospective minimal residual disease monitoring to predict relapse of acute promyelocytic leukemia and to direct pre-emptive arsenic trioxide therapy J Clin Oncol 27: 36503658,2009 LinkGoogle Scholar
36. D Osborne, L Frost, K Tobal , etal: Elevated levels of WT1 transcripts in bone marrow harvests are associated with a high relapse risk in patients autografted for acute myeloid leukaemia Bone Marrow Transplant 36: 6770,2005 Crossref, MedlineGoogle Scholar
37. JP Van Dijk, GH Knops, LT Van De Locht , etal: Abnormal WT1 expression in the CD34-negative compartment in myelodysplastic bone marrow Br J Haematol 118: 10271033,2002 Crossref, MedlineGoogle Scholar
38. X Thomas, E Raffoux, S de Botton , etal: Effect of priming with granulocyte-macrophage colony-stimulating factor in younger adults with newly diagnosed acute myeloid leukemia: A trial by the Acute Leukemia French Association (ALFA) Group Leukemia 21: 453461,2007 Crossref, MedlineGoogle Scholar
39. C Pautas, X Thomas, F Merabet , etal: Randomized comparison of standard induction with daunorubicin (DNR) for 3 days vs idarubicin (IDA) for 3 or 4 days in AML pts aged 50 to 70 and of maintenance with interleukin 2. Final analysis of the ALFA 9801 study Blood 110: 55a,2007 abstr 162 Google Scholar
40. T Büchner, WE Berdel, C Schoch , etal: Double induction containing either two courses or one course of high-dose cytarabine plus mitoxantrone and postremission therapy by either autologous stem-cell transplantation or by prolonged maintenance for acute myeloid leukemia J Clin Oncol 24: 24802489,2006 LinkGoogle Scholar
41. F Lo-Coco, A Cuneo, F Pane , etal: Prognostic impact of genetic characterization in the GIMEMA LAM99P multicenter study for newly diagnosed acute myeloid leukemia Haematologica 93: 10171024,2008 Crossref, MedlineGoogle Scholar
42. EORTC protocol AML-12/06991 http://www.eortc.be/protoc/Details.asp?Protocol=06991 Google Scholar
43. D Grimwade, H Walker, F Oliver , etal: The importance of diagnostic cytogenetics on outcome in AML: Analysis of 1,612 patients entered into the MRC AML 10 trial—The Medical Research Council Adult and Children's Leukaemia Working Parties Blood 92: 23222333,1998 Crossref, MedlineGoogle Scholar
44. HJ Stauss, S Thomas, M Cesco-Gaspere , etal: WT1-specific T cell receptor gene therapy: Improving TCR function in transduced T cells Blood Cells Mol Dis 40: 113116,2008 Crossref, MedlineGoogle Scholar
45. J Greiner, H Döhner, M Schmitt: Cancer vaccines for patients with acute myeloid leukemia: Definition of leukemia-associated antigens and current clinical protocols targeting these antigens Haematologica 91: 16531661,2006 MedlineGoogle Scholar
46. E Barragán, J Cervera, P Bolufer , etal: Prognostic implications of Wilms' tumor gene (WT1) expression in patients with de novo acute myeloid leukemia Haematologica 89: 926933,2004 MedlineGoogle Scholar

Acknowledgment

We thank Patricia Hoogeveen and Nicolas Maroc for technical assistance, Michelle Sale for data collection, Karin Summers for sample preparation, and Francesca Messa for assistance in the preparation of the figures; Peter Rohon, MD (Department of Hemato-oncology, University Hospital Olomouc, Czech Republic), Jaroslav Polák, and Cedrik Haskovec, PhD (DNA Diagnostics, Institute of Hematology, Prague, Czech Republic) also made significant contributions to this study.

Table

Table A1. Sequences of the Primers and Probes for the Nine Evaluated WT1 Assays

Table A1. Sequences of the Primers and Probes for the Nine Evaluated WT1 Assays

WT1 Assay Primer and Probe Sequences Location Reference
1 5′-GATAACCACACAACGCCCATC-3′ (Fwd) Exon 6 Ogawa et al
5′-ACACCGTGCGTGTGTATTCTGTATTGG-3′ (Probe) Exon 6
5′-CACACGTCGCACATCCTGAAT-3′ (Rev) Exons 6-7
2 5′-AGCTGTCCCACTTACAGATGCAC-3′ (Fwd) Exon 7 Osborne et al
5′-CAGGAAGCACACTGGTGAGAAACCATACCA-3′ (Probe) Exons 7-8
5′-TTCGTTCACAGTCCTTGAAGTCAC-3′ (Rev) Exon 8
3 5′-AGAATACACACGCACGGTGTCT-3′ (Fwd) Exon 6 Østergaard et al
5′-CTCCAGGCACACGTCGCACATCCTG-3′ (Probe) Exons 6-7
5′-GATGCCGACCGTACAAGAGTC-3′ (Rev) Exon 7
4 5′-TGCACAGCAGGAAGCACACT-3′ (Fwd) Exon 7 Unpublished
5′-TGACTTCAAGGACTGTGAAC-3′ (Probe) Exon 8
5′-TCTTTTGAGCTGGTCTGAACGA-3′ (Rev) Exon 8
5 5′-TGCACAGCAGGAAGCACACT-3′ (Fwd) Exon 7 Unpublished
5′-TGACTTCAAGGACTGTGAAC-3′ (Probe)* Exon 8
5′-TCTTTTGAGCTGGTCTGAACGA-3′ (Rev) Exon 8
6 5′-CAGATGCACAGCAGGAAGCA-3′ (Fwd) Exon 7 Unpublished
5′-AAGTCACACTGGTATGGTT-3′ (Probe) Exon 8
5′-AGAAAACCTTCGTTCACAGTCCTT-3′ (Rev) Exon 8
7 5′-CAGATGCACAGCAGGAAGCA-3′ (Fwd) Exon 7 Unpublished
5′-AAGTCACACTGGTATGGTT-3′ (Probe)* Exon 8
5′-AGAAAACCTTCGTTCACAGTCCTT-3′ (Rev) Exon 8
8 5′-CAGGCTGCAATAAGAGATATTTTAAGCT-3′ (Fwd) Exon 7 Cilloni et al
5′-CTTACAGATGCACAGCAGGAAGCACACTG-3′ (Probe) Exon 7
5′-GAAGTCACACTGGTATGGTTTCTCA-3′ (Rev) Exon 8
9 5′-CGCTATTCGCAATCAGGGTTA-3′ (Fwd) Exons 1-2 Van Dijk et al
5′-AGCACGGTCACCTTCGACGGGA-3′ (Probe) Exon 2
5′-GGGCGTGTGACCGTAGCT-3′ (Rev) Exon 2

*Denotes minor groove binding probe; for the remaining assays FAM/TAMRA-labeled probes were used. (Ogawa H, Tamaki H, Ikegame K, et al: Blood 101:1698-1704, 2003; Osborne D, Frost L, Tobal K, et al: Bone Marrow Transplant 36:67-70, 2005; Østergaard M, Olesen LH, Hasle H, et al: Br J Haematol 125:590-600, 2004; Cilloni D, Gottardi E, De Micheli D, et al: Leukemia 16:2115-2121, 2002; Van Dijk JP, Knops GH, Van De Locht LT, et al: Br J Haematol 118:1027-1033, 2002)

Table

Table A2. Results of Phase I: Comparison of Nine WT1 Assays Tested on Serial Dilutions of HL60 Cells in Peripheral Blood Lymphocytes

Table A2. Results of Phase I: Comparison of Nine WT1 Assays Tested on Serial Dilutions of HL60 Cells in Peripheral Blood Lymphocytes

Dilution Mean WT1 Cycle Threshold Value
Assay 1 Assay 2 Assay 3 Assay 4 Assay 5 Assay 6 Assay 7 Assay 8 Assay 9
Undiluted HL60 25.84 32.31 24.67 29.96 30.07 31.14 26.03 27.95 24.27
10−1 27.09 35.07 27.93 33.50 31.15 36.54 27.56 31.18 27.40
10−2 31.23 37.66 30.43 36.48 35.46 40.56 31.48 34.01 29.99
10−3 33.69 41.03 33.60 39.49 38.27 45.39 34.18 36.97 33.65
10−4 36.99 45.00 37.14 43.16 42.05 49.73 38.06 40.78 35.60
10−5 39.52 50 39.95 46.60 50 50 40.42 43.85 37.60
10−6 39.25 50 50 49.49 50 50 40.96 50 50
Undiluted lymphocytes 39.57 49.17 38.40 46.51 50 50 41.31 43.51 37.91

NOTE. Mean WT1 cycle threshold values observed following amplification of cDNA derived from serial dilutions of HL60 cells in peripheral blood lymphocytes. Assay 1 was found to amplify genomic DNA and therefore was excluded at this stage, along with Assays 4 and 6 which exhibited poor levels of sensitivity.

Table

Table A3. Results of Phase II: Comparison of Six WT1 Assays Tested on Plasmid Serial Dilutions

Table A3. Results of Phase II: Comparison of Six WT1 Assays Tested on Plasmid Serial Dilutions

Variable Mean WT1 Cycle Threshold Value (for each plasmid dilution)
Assay 2 Assay 3 Assay 5 Assay 7 Assay 8 Assay 9
Plasmid serial dilution
    1 × 106 28.50 19.23 21.70 20.25 21.61 19.14
    1 × 105 31.92 22.60 25.61 23.93 25.30 22.42
    1 × 103 39.18 29.63 33.42 31.16 32.63 29.50
    1 × 102 42.78 32.78 37.36 34.64 36.47 32.75
    1 × 101 45.82 36.08 41.08 38.26 39.96 36.35
Slope −3.51 −3.38 −3.895 −3.596 −3.69 −3.444
Intercept 49.57 39.56 45.09 41.87 43.69 39.74
Correlation coefficient 0.992 0.996 1 1 1 0.999

NOTE. For assays with maximal efficiency, the slope value is −3.3; therefore, Assays 3 and 9 were the most efficient, with the cycle threshold value equivalent to one copy (indicated by Intercept on y-axis) falling below the detection limit of 40 cycles. These assays were taken forward for further evaluation in phase III with Assay 8.

COMPANION ARTICLES

No companion articles

ARTICLE CITATION

DOI: 10.1200/JCO.2009.22.4865 Journal of Clinical Oncology 27, no. 31 (November 01, 2009) 5195-5201.

Published online September 14, 2009.

PMID: 19752335

ASCO Career Center